Week 10 & 11 (11/04- 11/15) ------------------------------------------------------------------------------------------

- Spun down second Master plate overnight samples -> Miniprep -> Nanodrop

Generally lower yield concentration than first master plate

Sample 1 - average of 97.2 ng/uL

Sample 2 - average of 77.0 ng/uL

Sample 3 - average of 131.8 ng/uL

Sample 4 - average of 67.9 ng/uL

Sample 5 - average of 71.6 ng/uL

Sample 6 - average of 100.1 ng/uL

Sample 7 - average of 85.5 ng/uL

Sample 8 - average of 82.5 ng/uL

Sample 9 - average of 87.5 ng/uL

- Submitted to DNA sequencing using pLIC For and Rev primers

-DNA Sequencing from Master Plate 1 ( samples 2-9) and Master Plate 2 came back

Sample 5 from Master Plate 1 was successful- Both For and Rev results had some missing or non-readable base pairs, but were complimented by each other.

Nucleotide Blast result of cloned MtubMabA in pNIC Bsa4 against codon optimized sequence of MtubMabA from DNAWorks output file. Query: DNA sequence result of sample 5 with pLIC Forward primer from Master Plate 1. Sbjct: true sequence of MtubMabA from DNAworks output file

Nucleotide Blast result of cloned MtubMabA in pNIC Bsa4 against codon optimized sequence of MtubMabA from DNAWorks output file. Query: DNA sequence result of sample 5 with pLIC Reverse primer from Master Plate 1. Sbjct: true sequence of MtubMabA from DNAworks output file

- Made 20mL of 50mg/mL Kan

1000mg of Kan sulfate power mixed with 20mL of autoclaved nanopure water and then syringe filtered. Divided into 20 1.7mL tubes and put into -20C fridge.

- Started overnight culture

used #5 colony from Master Plate 1
160mL of LB with 160uL of Kan
Put into the shaking incubator at 6:20 pm on 11/7/13
Performed MidiPrep and got 1000mL of plasmid
need to Nanodrop

- Protein Expression with positive clone - Small Culture

used Sample 5 from Master plate 1 prepared by Miniprep
concentration was 83.9 ng/uL -> 0.60uL to get 50ng
transformed 50uL of E.coli BL21 (DE3)
used Kan plates
added 10uL onto Plate A and 50uL to Plate B
In the 37 deg Celcius incubator for approx 24hrs and then moved to 4 deg Celcius fridge

Plate A: 10uL of MtubMabA and E.coli BL21 plated in kanamycin plate

Plate B: 50uL of MtubMabA and E.coli BL21 plated in kanamycin plate

Plate A seemed to have very tiny colonies but was impossible to pick and isolate each colony -> dispose
Plate B had good colonies-> will use for further protein expression steps -> stored in 4 deg Celcius fridge

- Found positive controls for the target protein

- Made 1000mL of LB media

10g of Trypton and NaCl, 5g of Yeast with 1000mL of water
autoclave cycle - LIQUID6

- Protein Expression- Large Culture

When all of 20mL of small culture to 500mL of LB, OD was 0.067, which was much lower than what it should have been, which was 0.1.
The large culture put into shaking incubator, since initial OD was lower, will stay in the incubator for longer than normal
OD of 0.584 at 9:36PM, Sample 0 was saved; 260uL of 1M IPTG was added to make final concentration of 500uM
incubated for 19 hours in water bath shaker at room temp.

- Protein Expression - Harvest

Forgot to save Sample 1 before centrifugation
centrifuged at 5900rpm (approx 6000g) for 20min at 4 degC using JA-10 rotor
used pre-made Lysis Buffer (100mM Tris, 300mM NaCl, 10mM Imidazole, pH 7.9)
Saved Sample 1 AFTER suspension in Lysis Buffer (don't know if this will be ok)
Pellet weight = 3.01g
Cell suspension saved in -20degC

Week 9 & 10 (10/21 - 11/01) ------------------------------------------------------------------------------------------

Excellent job documenting your progress! Continue working on virtual screening. It'll be helpful for you to make a table of known inhibitors and their structure to be used later on in your final report. - Suman 11/5/13

- Spun down Master plate overnight sample -> pallets formed even though the sample was frozen before spinning
- Miniprep on 9 samples -> need to verify the sequence -> DNA sequencing
- Nanodrop on 9 samples before DNA sequencing

Samples with concentration greater than 100 ng/uL will be submitted twice with For and Rev primers. Those that are less than 100 ng/uL will be submitted with only For primer, and if good sequence comes back, they will be re-submitted with Rev primers.
Sample 1- average of 105.9 ng/uL

Sample 2 - average of 97.5 ng/uL

Sample 3- average of 113.2 ng/uL

Sample 4- average of 107.0 ng/uL

Sample 5- average of 83.9 ng/uL

Sample 6- average of 90.5 ng/uL

Sample 7- average of 113.6 ng/uL

Sample 8- average of 117.3 ng/uL

Sample 9- 74.5 ng/uL

- DNA sequences came back ---> CDS Gene Sequence (codon optimized) missing from targets page-> got it from G.doc-> blast
(used tail primers for DNA sequencing ->WRONG!!!! (works but too close to the gene; need to use pLIC primers) -> will pick out good ones and resubmit with pLIC For and Rev)
- seq used for Blast:
ATGACCGCGACGGCGACCGAAGGTGCGAAACCGCCGTTCGTTTCCCGTAGCGTTCTCGTTACGGGTGGTA
ATCGTGGCATTGGTCTGGCTATCGCCCAACGTCTCGCTGCCGACGGTCACAAGGTTGCGGTTACTCACCG
TGGTTCTGGTGCGCCGAAAGGTCTGTTCGGTGTTGAGTGCGACGTTACTGATTCTGACGCGGTGGATCGC
GCTTTCACCGCTGTTGAAGAACACCAGGGTCCGGTAGAAGTACTCGTATCTAACGCCGGTCTGTCTGCGG
ACGCTTTCCTGATGCGTATGACTGAAGAAAAATTCGAAAAAGTTATTAACGCGAACCTGACCGGTGCGTT
CCGTGTTGCGCAGCGTGCGTCTCGTTCTATGCAGCGTAACAAGTTTGGTCGTATGATTTTCATCGGTTCT
GTTTCTGGTTCTTGGGGCATCGGCAACCAGGCGAATTATGCGGCGAGCAAAGCCGGTGTGATCGGTATGG
CGCGTTCCATCGCGCGTGAACTGTCTAAAGCTAATGTTACTGCTAACGTTGTCGCGCCTGGCTACATCGA
CACGGATATGACTCGCGCGCTCGACGAGCGTATCCAGCAGGGTGCGCTGCAATTCATCCCGGCCAAACGT
GTTGGTACCCCGGCAGAAGTTGCGGGTGTTGTCTCTTTTCTGGCGTCTGAAGACGCATCTTACATTTCCG
GTGCCGTTATCCCGGTCGACGGTGGCATGGGTATGGGTCACTAA

Sample 1: missing a base pair on both For and Rev -> cloning failure confirmed
Sample 2: might need to resubmit
Sample 3: For result looks good, but Rev result shows few missing or substituted base pairs
Sample 4~7,9: only short results came back, not enough to decide success/failure -> will resubmit with pLIC
Sample 8: For result too short to decide, Rev result shows missing, substituted, added base pairs

------> will resubmit samples 2-9 with pLIC

- Resubmitted MtubMabA cloning samples 2 ~ 9 with pLIC For and Rev primers

- Finding positive controls for Virtual Screening : from PubMed papers -> isoniazid, thiolactomycin, thiophenone

need to look at Brenda, Binding DB for substrates for MabA/FabG1 in other organisms

- Just in case all of cloning samples fail, made another Master plate

5mL of LB, 5uL of 50 ng/uL Kanamycin per tube
total of 9 samples: 3 colonies from each B, C, and D plates

Second Master Plate: MabA gene from M. tuberculosis in pNIC-Bsa4 vector cloned in E.coli DH5alpha

Week 7 & 8 (10/7 - 10/25) -------------------------------------------------------------------------------------------

Nice work on keeping your page updated. Good captions and analysis of your data. Where are you with virtual? Thank you. -Max 10/21/13

- Cut pNIC

pNIC concentration - 38.2 ng/uL
increased final volume to 70uL and recalculated other reagents proportionally.
made 4 tubes (70uL each)

- PCR^2

used Primary PCR from summer
Made 600uL of Master Mix -> 12 PCR tubes

- PCR clean up

pNIC vector -> combined 4 tubes into one tube and eluted in 50uL
PCR^2 -> combined all 12 tubes and eluted in 100uL

- Gel check on clean ups

Agarose gel electrophoresis result of pNIC -Bsa4 vector and MabA (M. tuberculosis) after PCR clean up

Well # ---------- Content
1 ------------------ skip
2 ------------------ skip
3 ------------------ skip
4 ------------------ skip
5 ------------------ NEB 1k bp DNA ladder
6 ------------------ pNIC vector after clean up
7 ------------------ skip
8 ------------------ Gene Ruler 100 bp DNA ladder
9 ------------------ PCR clean up of MabA from M. tuberculosis
geneRuler 100bp DNA ladder.jpg

The bands are in the correct place for both pNIC vector and the insert
However, the insert band is very faint (2uL of PCR clean up + 5uL of Loading dye + 13uL of water)
Suspicious about the concentration of insert -> will Nanodrop to make sure

- Nanodrop on PCR^2 and pNIC accepting vector

1st trial Nanodrop result of MtubMabA measured at 260nm. concentration of 132.0 ng/uL

2nd trial Nanodrop result of MtubMabA measured at 260nm. concentration of 133.1 ng/uL

PCR clean up product of MtubMabA PCR^2 had average concentration of 132.6 ng/uL

1st trial Nanodrop result of pNIC accepting vector after PCR clean up. Measured at 260nm. Concentration of 124.5 ng/uL

2nd trial Nanodrop result of pNIC accepting vector after PCR clean up. Measured at 260nm. Concentration of 125.1 ng/uL

PCR clean up product of pNIC-Bsa4 accepting vector had average concentration of 124.8 ng/uL

- Transformation -> 2nd Trial

Cohesive end generation:
- used NEB Buffer 2 instead of 10X T4 DNA Polymerase Buffer
- Diluted 1M DTT to 100mM DTT ( 100uL 1M DTT + 900uL water = 1000uL 100mL DTT)
- the heat block went up as high as 78 deg C (supposed to be at 75 deg C) ----> will this affect????
Annealing and Transformation :
- Made 4 tubes (vector : insert)
  - A- 2:4
  - B- 2:5
  - C- 3:8
  - D- 2:10
- used E.coli DH5alpha (Lot # C2987H)

- Transformation Result -> 3 of 4 plates had colonies

Plate A: 2uL T4 treated MabA from M. tuberculosis and 4uL T4 treated pNIC vector without SacB gene in E.coli DH5alpha

Plate B: 2uL T4 treated MabA from M. tuberculosis and 5uL T4 treated pNIC vector without SacB gene in E.coli DH5alpha

Plate C: 3uL T4 treated MabA from M. tuberculosis and 8uL T4 treated pNIC vector without SacB gene in E.coli DH5alpha

Plate D: 2uL T4 treated MabA from M. tuberculosis and 10uL T4 treated pNIC vector without SacB gene in E.coli DH5alpha

Colonies were big ( colonies were not this big when I grew up pNIC plasmid in DH5alpha) -> made sure that I used DH5alpha and NOT BL21
Do not know why the colonies are so big.
Number of colonies:
- A: 0
- B: 20
- C: 23
- D: 15
Ratio of 3 vector: 8 insert yielded highest number of colonies
Will make master plate

- Master plate & overnight cultures

Picked 3 colonies from each B, C, D --> 9 colonies on the master plate and made 9 overnight culture.
grown overnight
stored overnight culture in -20degC BEFORE spinning down --> if pallets form, ok: if not, need to grow overnight cultures again using master plate.

Master Plate: MtubMabA-pNIC in E.coli DH5alpha. 1-3 from Plate B, 4-6 from Plate C, 7-9 from Plate D

Week 5 & 6 (9/23 - 10/4) -----------------------------------------------------------------------------------------------

NIice Job with the captions and analyses. Keep up the good work. -Max 10/07/2013

- To do list:

cut pNIC + PCR^2 (make bunch)

- First trial pNIC cloning failed - nothing grew on 5% sucrose plate

pNIC might have been too old (grown up during summer)
Extended RT incubation during cohesive end generation might have had effect
heat shock too long??? (30sec according to protocol)
Maybe need to grow up pNIC again

Plate A: 2uL T4 treated MabA from M. tuberculosis and 4uL T4 treated pNIC vector without SacB gene in E.coli DH5alpha

Plate B: 3uL T4 treated MabA from M. tuberculosis and 5uL T4 treated pNIC vector without SacB gene in E.coli DH5alpha

- Attempted first trial of pNIC cloning

During cohesive end generation: incubated at RT for 1hr instead of 30min
had only 5X T4 DNA polymerase Buffer instead of 10X -> doubled the buffer vol and decreased water volume
used E. coli DH5alpha
heat shock for 45 seconds
pNIC vector - grown up during summer, sequence verified
A- 2 vector : 4 insert
B- 3 vector : 5 insert

- Nanodropped PCR clean up products

MabA from M. tuberculosis prepared on 9/3/13 - avg. concentration of 197.2 ng/uL

First trial Nanodrop result of MtubMabA concentration after PCR clean up done on 09/30/13. Measured at 260nm. Concentration of 198 ng/uL

Second trial Nanodrop result of MtubMabA concentration after PCR clean up done on 09/30/13. Measured at 260nm. Concentration of 196.4 ng/uL

MabA from M. tuberculosis prepared on 7/18/13 - avg. concentration of 21.6 ng/uL
- Dr.B said it's too old -> will dispose

First trial Nanodrop result of MtubMabA concentration after PCR clean up done on 07/18/13. Measured at 260nm. Concentration of 21.7 ng/uL

Second trial Nanodrop result of MtubMabA concentration after PCR clean up done on 07/18/13. Measured at 260nm. Concentration of 21.4 ng/uL

pNIC vector Nanodrop result after SacB gene cut out and after PCR clean up ; prepared on 09/30/13
- average concentration of 100.6 ng/uL

First trial Nanodrop result of pNIC accepting vector after PCR clean up done on 09/30/13. Measured at 260nm. Concentration of 101.2 ng/uL.

Second trial Nanodrop result of pNIC accepting vector after PCR clean up done on 09/30/13. Measured at 260nm. Concentration of 100.0 ng/uL

pNIC vector Nanodrop result after SacB gene cut out and after PCR clean up ; prepared on 07/19/13
- average concentration of 23.7 ng/uL
- also too old -> will dispose

First trial Nanodrop result of pNIC accepting vector after PCR clean up done on 07/19/13. Measured at 260nm. Concentration of 24.3 ng/uL

Second trial Nanodrop result of pNIC accepting vector after PCR clean up done on 07/19/13. Measured at 260nm. Concentration of 23.1 ng/uL

- PCR clean up on PCR^2 and pNIC accepting vector

PCR^2: eluted in 50uL
pNIC: eluted in 30uL
ran a gel check along with summer PCR^ clean up (eluted in 500uL instead) and summer pNIC vector clean up just to see how they come out

Well # ---------- Content
1 ------------------ NEB 100 bp DNA ladder
2 ------------------ PCR^2 clean up of MabA from M. tuberculosis Why are these different heights on the gel? - Dr. B 100113
3 ------------------ PCR^2 clean up from summer (eluted in 500uL by accident) <--
4 ------------------ skip
5 ------------------ NEB 1k bp DNA ladder
6 ------------------ pNIC vector clean up
7 ------------------ pNIC vector clean up from summer

- Gel check on pNIC accepting vector

Agarose gel electrophoresis of pNic-Bsa4 vector with SacB gene cut out.

Well # ---------- Content
1 ------------------ NEB 1kb bp DNA ladder
2 ------------------ skip
3 ------------------ Tube A: pNIC-Bsa4 with SacB gene cut out
4 ------------------ skip
5 ------------------ Tube B: pNIC-Bsa4 with SacB gene cut out
6 ------------------ skip

I made two tubes of accepting vector just in case, hence Tube A and B.
pNIC plasmid's concentration (prepared by Midiprep) was too low, so I increased the final volume to 60uL and calculated other reagents' volume proportionally
The upper bands in Lane 3&5 are the big section of pNic plasmid without the SacB gene and the lower bands are the SacB gene DNA that have been cut out. The upper bands are darker than the lower bands even though their concentration are the same, because smaller SacB gene has much less space for EtBr to bind, which is the reagent that makes DNA glow.
The two separate (upper and lower) bands indicate that pNIC has been cut correctly.

- Made 50X TAE buffer

57.1 mL glacier acetic acid
242 g Tris Base
37.2 g Na2EDTA H20
Added those ingredients to 1000 mL graduated cylinder and filled it up to 1000 mL mark with nanopure water.

- Nanodropped PCR^2 from secondary PCR (summer)

average concentration of 304.6 ng/uL

First trial Nanodrop of PCR squared of MabA from M. tuberculosis using secondary PCR (summer). Measured concentration of 308.5 ng/uL

Second trial Nanodrop of PCR squared of MabA from M. tuberculosis using secondary PCR (summer). Measured concentration of 300.7 ng/uL

Week 3 & 4 (9/9 - 9/20)--------------------------------------------------------------------------------------------------------------------

Young, ok making some progress but keep the pressure on to get your clonign done. For gel images - embed the image vs. linking it. - Dr. B 100113

- messed up PCR clean up at the end of summer, restarting from oligo mix
- Made Oligo mix (little pieces of my gene MtubMabA), Primary PCR (gluing the pieces together), Secondary PCR (copying only full length genes), PCR^2 (amplifying secondary PCR product)
- (9/13) Attempted gel electrophoresis on Primary, Secondary, and PCR^2. Voltage set to 130, ran about 50 min. When finished, the buffer inside the rig was hotter than usual and the gel was extremely fragile. It was impossible to take the gel out of the buffer without breaking the gel.

At next attempt, I will lower the voltage, run the gel for longer time, and leave the gel in the casket when putting into the rig.

- (9/16) Re-attempted gel electrophoresis on Secondary and PCR^2. Voltage set at 110 and ran for 50 min. Run was successful.

HL_PCRs_091613.bmp

NEB 100bp DNA ladder

Well # ---------- Content
1 ------------------ NEB 100 bp DNA ladder
2 ------------------ Secondary PCR using Primary PCR from 9/9/13
3 ------------------ PCR^2 using Secondary PCR (9/9/13)
4 ------------------ skip
5 ------------------ NEB 100 bp DNA ladder
6 ------------------ Secondary PCR using Primary PCR from Summer
7 ------------------ PCR^2 using Secondary PCR (Summer)

The bands are between 700 and 800 bp, which is the correct spot, since my gene is 744bp. On Well #3, there is a big smear between 100 bp and 200 bp. This might be contamination or gene fragments from Primary and Secondary PCR.

- pNIC-Bsa4 vector preparation. My pNIC concentration was 42.2 ng/uL. In order to get 2.25 ug (according to the protocol) I needed 53.3 uL, which was too much volume than the protocol (total of 25uL). So, I readjusted the total volume to be 60uL and calculated proportions of other reagents. After combining all the necessary reagents, the tubes were put into 37 degree Celcius water bath from 2:14 PM to 4:25 PM. Then the tubes were stored at -20 C for later use. (PCR clean up, gel electrophoresis, and Nanodrop will be performed later.)

Week 1 & 2 (8/28 - 9/6)--------------------------------------------------------------------------------------------------------------------

Young - show some images for results (e.g. at least an image of PyMol refresher. Should have some PCR attempts here. WOrk on making pNIC-Bsa4 also. - Dr. B 090913

8/30
- made 1000mL of LB (no antibiotics)
9/3
- PyMol refresher

+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++

Week8 (7/22 -7/26)------------------------------------------------------------------------

7/22
- research presentation
- DNA sequence not back yet

Week7 (7/15 - 7/19)-----------------------------------------------------------------------------------------------------------------------------------------

Young - good job. Band looks nice. Be sure to do teh LIC cloning exercise (paper based). I would recommend growting more pNIC-Bsa4 since the conc was low. Be sure to elute in only 500ul - Dr. B 071713

7/19
- PCR^2 clean up ERROR: eluted in 500uL instead of 50uL.... also did not Nanodrop it before clean up
- Vector preparation ERROR: did not run the gel before clean up -> too little sample for running gel

solutions to both errors: will redo both steps using 3rd MidiPrep product

- 3rd MidiPrep

collected pellets from yesterday's culture and cont. to MidiPrep
eluted with only 500uL of elution buffer instead of 1000uL to increase the concentration
average concentration of 42.2 ng/uL
halved the elution the volume but concentration was not much higher

Fig.1: First trial Nucleic acid Nanodrop result of pNIC-Bsa4 plasmid prepared by MidiPrep on 07/19/13. Measured at 260nm. Resulting concentration of 42.2 ng/uL

Fig.2: Second trial Nucleic acid Nanodrop result of pNIC-Bsa4 plasmid prepared by MidiPrep on 07/19/13. Measured at 260nm. Resulting concentration of 42.1 ng/uL

- submitted to DNA sequencing with pLIC-for and rev

DNA sequencing order form of pNIC-Bsa4 plasmid prepared by MidiPrep on 071913 with pLIC Forward and Reverse primers

7/18
- PCR clean up -> stored in my box (-20C)

had 200uL of PCR^2 product -> needed 1000uL of Binding Soln.... did not fit into the column
divided into two columns: 500uL of Binding soln and 100uL of PCR^2 in each column
used Tris-HCl (0.5M, pH of 6.92) instead of Elution soln provided in the clean up box

- Vector preparation

used 37.5 ng/uL pNIC-Bsa4 (prepared by first MidiPrep on 6/11 because second MidiPrepped pNIC conc. was so low ->25.6 ng/uL)
doubled the final volume from 25uL to 50uL due to low plasmid concentration... needed 60uL for 2.25ug of pNIC
water bath for 3 hrs -> will due clean up tomorrow, stored in -20C

- 160mL of pNIC Bsa4 overnight culture for MidiPrep

7/17
- after successful secondary PCR, proceed to PCR squared

massive producing of secondary PCR product
much will be lost during clean up process

- PCR result

agarose gel electrophoresis result of Primary and Secondary PCR of MtubMabA. 1k bp DNA ladder was used.

well# -------------- content
1 -------------------- 5uL of 1k bp DNA ladder
2 -------------------- Primary PCR of MtubMabA
3 -------------------- Secondary PCR of MtubMabA

- Ran gel electrophoresis of primary and secondary

Primary should be a smear and secondary should have a band
used 1k bp ladder
added 2uL of Blue Juice to 15uL of samples

7/16
- Primary and Secondary PCR on MtubMabA
- Made Oligo mix for MtubMabA
- DNA seq of pNIC-Bsa4 prepared by MidiPrep came back

with pLIC-For

NNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNANATACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTG
GGTACCGAGAACCTGTACTTCCAATCCATGGAGACCGACGTCCACATATACCTGCCGTTCACTATTATTTAGTGAAATGA
GATATTATGATATTTTCTGAATTGTGATTAAAAAGGCAACTTTATGCCCATGCAACAGAAACTATAAAAAATACAGAGAA
TGAAAAGAAACAGATAGATTTTTTAGTTCTTTAGGCCCGTAGTCTGCAAATCCTTTTATGATTTTCTATCAAACAAAAGA
GGAAAATAGACCAGTTGCAATCCAAACGAGAGTCTAATAGAATGAGGTCGAAAAGTAAATCGCGCGGGTTTGTTACTGAT
AAAGCAGGCAAGACCTAAAATGTGTAAAGGGCAAAGTGTATACTTTGGCGTCACCCCTTACATATTTTAGGTCTTTTTTT
ATTGTGCGTAACTAACTTGCCATCTTCAAACAGGAGGGCTGGAAGAAGCAGACCGCTAACACAGTACATAAAAAAGGAGA
CATGAACGATGAACATCAAAAAGTTTGCAAAACAAGCAACAGTATTAACCTTTACTACCGCACTGCTGGCAGGAGGCGCA
ACTCAAGCGTTTGCGAAAGAAACGAACCAAAAGCCATATAAGGAAACATACGGCATTTCCCATATTACACGCCATGATAT
GCTGCAAATCCCTGAACAGCAAAAAAATGAAAAATATAAAGTTCCTGAGTTCGATTCGTCCACAATTAAAAATATCTCTT
CTGCAAAAGGCCTGGACGTTTGGGACAGCTGGCCATTACAAAACACTGACGGCACTGTCGCAAACTATCACGGCTACCAC
ATCGTCTTTGCATTAGCCGGANATCCTAAAAATGCGGATGACACATCGATTTACATGTTCTATCAAAAAGTCGGCGAAAC
TTCTATTGACAGCTNGNAAAACGCTGGNCNNGTCNTTAANACAGCGACAANTCGATGCNNTGATNCTATCCTAAANANCN
ANNNCNAGAATGGNCNGGNTCANCNNNNTTTANNTNNNGACGNAAAATCGTTNNNTCTACNNNGATTNNNCNGGNAANNN
NCGNNNNAANNCTGANANTNNNNNNNTNNCNNNTCNNCNTCNNNNNNNTCNTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNANNNTACGNNNNNNTNNNANNNNNNNNNNNNNNNNNNNNNNGNNN

pLIC-For Blast result

Nucleotide blast result of pNIC-Bsa4 prepared by MidiPrep. Max identity of 99% against known sequence of pNIC.

with pLIC - Rev

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTGGTGGTGCTCGAGTGCGGCCGCAAGCTTGTCGACGGAGCTCG
AANNCNNNTCCGTATCCACCTTTACTGGAGACCGTCAATGCCAATNNNNNNNCNGCATTTTCTTTTGCGTTTTTATTTGT
TAACTGTTAATTGTCCTTGTTCAAGGATGCTGTCTTTGACAACNNATGTTTTCTTGCCTTTGATGTTCAGCAGGAAGCTA
GGCGCAAACGTTGATTGTTTGTCTGCGTAGAATCCTCTGTTTGTCATATAGCTTGTAATCACGACATTGTTTCCTTTCGC
TTGAGGTACAGCGAAGTGTGAGTAAGTAAAGGTTACATCGTTAGGATCAAGATCCATTTTTAACACAAGGCCAGTTTTGT
TCAGCGGCTTGTATGGGCCAGTTAAAGAATTAGAAACATAACCAAGCATGTAAATATCGTTAGACGTAATGCCGTCAATC
GTCATTTTTGATCCGCGGGAGTCAGTGAACAGGTACCATTTGCCGTTCATTTTAAAGACGTTCGCGCGTTCAATTTCATC
TGTTACTGTGTTAGATGCAATCAGCGGTTTCATCACTTTTTTCAGTGTGTAATCATCGTTTAGCTCAATCATACCGAGAG
CGCCGTTTGCTAACTCAGCCGTGCGTTTTTTATCGCTTTGCAGAAGTTTTTGACTTTCTTGACGGAAGAATGATGTGCTT
TTGCCNTANNATGCTTTGTTAAATAAAGATTCTTCGCCTTGGTAGNCATCTTCAGTTCCAGTGTTTGCNNCAAATANNAA
GTATTTGTGGCCTTTATCTNCTACNTAGTGAGGNNNNNCTCANNNANGGNNGNCGCCTGANNNGNANTNGCCNTCATCNN
NGAACTGCTGTACNNATTNANACNNNNTNNCGNNACCNTNNNNNN

pLIC-Rev Blast result

Nucleotide blast result of pNIC-Bsa4 prepared by MidiPrep with pLic-Rev. Max identity of 97% against known pNIC sequence

7/15
- made Oligo Mix for my target -> MtubMabA

have 18 primers
final concentration of 1uM

Week6 (7/8 - 7/12)-----------------------------------------------------------------------------------------------------------------

- RE Digest

HL_pLICpcr_070913.bmp

agarose gel electrophoresis result of restriction enzyme digest.

needs DNA seq Analysis (virtual gel) for further analysis

- pNIC-Bsa4 Midi Prep
- Nanodropped for concentration -> avg of 25.6 ng/uL

1st trial Nanodrop result of pNIC Bsa4 plasmid prepared by MidiPrep. Measured at 260nm for nucleic acid. Resulting concentration of 24.3 ng/uL

2nd trial Nanodrop result of pNIC Bsa4 plasmid prepared by MidiPrep. Measured at 260nm for nucleic acid. Resulting concentration of 26.9 ng/uL

Week5 (7/1 - 7/5)-------------------------------------------------------------------------------------------------------------------

- pmCherry PCR

Agarose gel electrophoresis result of pmCherry PCR

well# ---------- content
1 --------------- 100bp DNA ladder
2 --------------- 0.01 ng/uL pmCherry DNA with VDSR primer
3 --------------- 0.1 ng/uL pmCherry DNA with VDSR primer
4 --------------- 1.0 ng/uL pmCherry DNA with VDSR primer
5 --------------- no DNA with VDSR (could be contamination or trans-over from well 4)
6 --------------- 0.01 ng/uL pmCherry DNA with M13 primer
7 --------------- 0.1 ng/uL pmCherry DNA with M13 primer
8 --------------- 1.0 ng/uL pmCherry DNA with M13 primer
9 --------------- no DNA with M13 primer (could be contamination or trans- over from well 8)
** VDSR primers worked better than M13 on pmCherry. The marks were much brighter and distinctive.

Week4 (6/24 - 6/28)--------------------------------------------------------------------------------------------------------------------

------------------------------------------------------SICK------------------------------------------------------------------------------------------------------------------------------------------------------------

Week3 (6/17 - 6/21)-------------------------------------------------------------------------------------------------------------------

- 2nd trial of pGBR22 PCR

used pGBR22 with concentration of 156.9 ng/uL
ERROR: did NOT dilute taq

- tried to run gel on 2nd PCR

wells were broken due to weak (really soft) gel and samples were lost in the buffer

6/19

- pGFP gel result -> failed...no bands... only smears

Agarose gel electrophoresis result of pGFP PCR.

Well# ---------- content
1 ----------------- 100bp DNA ladder
2 ----------------- 0.05 ng/uL pGFP plasmid with VDSR primers
3 ----------------- 0.5 ng/uL pGFP plasmid with VDSR primers (LOST!!!!!!!!!)
4 ----------------- 4.5 ng/uL pGFP plasmid with VDSR primers
5 ----------------- no plasmid with VDSR primers
6 ----------------- 0.05 ng/uL pGFP plasmid with M13 primers
7 ----------------- 0.5 ng/uL pGFP plasmid with M13 primers
8 ----------------- 4.5 ng/uL pGFP plasmid with M13 primers
9 ----------------- no plasmid with M13primers
** including final extension period to repeating cycle may have affected the result

- pGFP (green) PCR

plasmid concentration of 450 ng/uL
for primers, used M13-F&R and VDS1&2
ERROR: 'Final Extension' step in PCR was included in repeating cycle (wasn't suppose to)
samples left on the PCR machine overnight and collected to my box on 6/20
saved samples for running gel later

- overnight culture growth of yopH in pNIC-Bsa4

100mL of LB + 100uL of Kan

6/20
- yopH Protein Expression

did not do transformation (putting plasmid into the bacteria), instead used someone else's already-transformed colony
monitored OD (optical density)
final: 20mL of overnight culture solution to 500mL of LB to make OD measurement to 0.1
incubated in shaking incubator for 2 hours to make OD 0.533
Sample 0: collected 500uL of soln (cell lysate before induction)
added IPTG (250uL) & incubated for 4 hrs
Sample 1: collected 500uL of soln after incubation (cell lysate after induction)
harvested by centrifugation
- pellet weight of 0.13g

- pmCherry (red) PCR

plasmid concentration of 112.6 ng/uL
primers: VDSR and M13
did not make master mix because the protocol did not have any measurements

Week2 (6/10 - 6/14)----------------------------------------------------------------------------------------------------------------

- result of 1st PCR

Result of pGBR22 PCR gel electrophoresis.

well#--- content
1-------- 100 bp DNA ladder
2-5------ Grace T.'s sample A-D
6-9------ My sample A-D -> PCR failed

6/10
- Overnight culture using colonies from Wk1 (pNIC Bsa4)

6/11
- Midi Prep using sample from 6/10 (pNIC Bsa4)
- Nanodropped resulting plasmid ------- avg. concentration of 37.5ng/uL

First trial Nanodrop result of pNIC Bsa4 plasmid from MidiPrep. Measured concentration of 38.5ng/uL

Second trial Nanodrop result of pNIC-Bsa4 plasmid prepared from MidiPrep. Measured concentration of 36.5ng/uL

- Submitted DNA seq using pLic-For as primer

Order form for DNA seq. submission

HL1_pLic-For.Seq_blast_result_070813.JPG

Blast result of MidiPrepped plasmid and know pNIC-Bsa4. 'Query' is the MidiPrep plasmid and 'Sbjct' is the known seq. 'N's indicate bases that were unverifiable.

To determine the 'N's, I viewed Chromatogram from coreweb.utexas.edu and checked each 'N' up to Query 801.
Did not check after base 801 since the result toward the end is relatively unreliable since only used pLic-For.
For improved result, could resubmit using pLic-Rev

Week1 (6/3 - 6/7)---------------------------------------------------------------------------------------------------------------------

6/3
- Dilution of primer: sp6 promoter from 100 microM to 10 microM
- Nanodrop of pmCherry

Nadodrop result of pmCherry plasmid. Measured at 230 nm. Concentration was 205.5 ng/uL

- Submitted DNA sequencing:
used 204ng/uL pmCherry with M13F primer
1st trial: said they will rerun with more samples

Result of pmCherry DNA sequencing. 'N' indicates unverifiable result.

2nd trial: came back with four Ns- could have been error in prepping the sample or used wrong primer

result of 2nd trial of DNA seq of pmCherry.

6/4
- Made 5 agar plates with kanamycin

6/5
- 1st PCR

6/6- 6/7

- Transformation Efficiency

Fig. 1: Plate A- 2ng of pNIC BSA4 with E. coli DH5α in agar plate containing kanamycin. Approximately 1080 colonies.

Fig. 2: Plate B- 10ng of pNIC BSA4 with E. coli DH5α in agar plate containing kanamycin. Approximately 456 colonies

Fig. 3: Plate C- 50ng of pNIC BSA4 with E. coli DH5α in agar plate containing kanamycin. Approximately 68 colonies.

Transformation Efficiency calculation:
Plate A: 1080 colonies / 2ng plasmid = 540 colonies per ng plasmid (pNIC BSA4)
Plate B: 456 colonies / 10ng plasmid = 45.6 colonies per ng plasmid (pNIC BSA4)
Plate C: 68 colonies / 50ng plasmid = 1.36 colonies per ng plasmid (pNIC BSA4)

Hyun-Young L.